Table 1

Primers and paired probes used to test QASM assay.

Primers and oligosSequence 5' to 3'TmAmplicon size
QASM assay
    SGIP1-forwardTTTAGAGATTATGGAGTTTTTTAGAAGGGTT59.4113
    SGIP1-reverseTCATAAACTACCCTACCCTTTTCTTCCTT60.9
    SGIP1-M FAM probe6FAM-GTTTTGGGGGATTTACGA-MGB-NFQ69.0
    SGIP1-U VIC probeVIC-GTTTTGGGGGATTTATGA-MGB-NFQ69.0
    FHIT-forwardATTCGATGAGTTTATTGTATTGTTTATTTATTTG59.6127
    FHIT-reverseTCATACCCCAAACATAAACATCATACA59.3
    FHIT-M FAM probe6FAM-TGATTTCGGGGTGTATA-MGB-NFQ64.0
    FHIT-U VIC probeVIC-TTTGATTTTGGGGTGTAT-MGB-NFQ64.0
    KAZN-forwardTTGGAAGAGGAGTTATAATGTAGGATGTTG60.996
    KAZN-reverseCCTCTTAAATCCCTTCAAACCTTTTCTTAT59.6
    KAZN-M FAM probe6FAM-TTAAGGTAGGTAAGCGTGG-MGB-NFQ66.0
    KAZN-U VIC probeVIC-AAGGTAGGTAAGTGTGGTGT-MGB-NFQ66.0
    CDO1-forwardGGAGGATGAATTTTATAGATTTGAATTTGATTTG59.593
    CDO1-reverseCACCCCCAAACCCCTAACA59.1
    CDO1-M FAM probe6FAM-CAATAAATCCGAAATC-MGB-NFQ66.0
    CDO1-U VIC probeVIC-CAATAAATCTGAAATC-MGB-NFQ65.0
ALU-C4 control reaction
    ALU-C4-forwardGGTTAGGTATAGTGGTTTATATTTGTAATTTTAGTA59.198
    ALU-C4-reverseATTAACTAAACTAATCTTAAACTCCTAACCTCA59.4
    ALU-C4-probeNED-CCTACCTTAACCTCCC-MGB-NFQ70.0
Bisulfite pyrosequencing assay
    SGIP1-forwardTGAGTTTTTTTGAAGGGAATTAAGGG60.989
    SGIP1-reverseACCTAACTACTCTCCAAAAACCATAAA60.1
    SGIP1-sequencing primerACCCAACCCTAAAAAAT46.2
    FHIT-forwardTGATAAATTTGTTAAAAGAAAGAGGAAGTA58.4168
    FHIT-reverseCCTATAAAACAAACCCACATATACAC58.1
    FHIT-sequencing primerCCCACATATACACCC44.6
    KAZN-forwardGGGATTTTAATTGTTATTGGAGAATAGG59.5250
    KAZN-reverseAAAACATTAATTCCCAAATACTTAAATTCT58.6
    KAZN-sequencing primerCAAAAACACACCAAAAC44.8
    CDO1-forwardTTATAGATTTGAATTTGATTTGTGTG53.679
    CDO1-reverseCCCCCAAACCCCTAACAAC57.7
    CDO1-sequencing primerAATTTGATTTGTGTGTGTAT43.8