Table 2. Primers and probes used in RT-RPA assay.
NameaSequence (5′-3′)Source
Sag59aTTTCACCAGCTGTATTAGAAGTACATGCTGATCIntegrated DNA Technologies
cfbSag263ACTGTCTCAGGGTTGGCACGCAATGAAGTCIntegrated DNA Technologies
cfbSag159-E1-A1GCTTGATCAAGATAGCATTCAGTTGAGAAA (FAMdT)(THF)(BHQ1dT)CAAAGATABiosearch Technologies
ATGTTCAGGG(Spacer-C3)b
ABgl158bAGAGGTCGCACTTCATTTAGGCGACGATACTIntegrated DNA Technologies
ABgl345cACGGAGCTTGTCTGTGAATCGGATCTTTCTCIntegrated DNA Technologies
ABgl220-E1-M2GCGCGGAATGGAAGCGGTGGACCAAGGTTCBiosearch Technologies
(M2dT)C(THF)(BHQ2dT)ATTTCAGT
GCCGGTT(phosphate)c
  • a Sag59a/cfbSag263, GBS forward/reverse primers; cfbSag159-E1-A1, GBS RT-RPA probe; ABgl158b/ABgl345c, ICRPA forward/reverse primers; ABgl220-E1-M2, ICRPA RT-RPA probe.

  • b FAMdT, fluorescein linked to thymidine; THF, tetrahydrofuran spacer; BHQ1dT, Black Hole Quencher 1 linked to thymidine; Spacer-C3, 3′ Spacer-C3 blocking elongation.

  • c M2dT, Texas Red linked to thymidine; phosphate, 3′ phosphate blocking elongation.