Table 1.

Oligonucleotides used for real-time PCR amplification, detection, and sequencing.

NameSequence, 5′→3′Use
ICFACAAGATCTCCGGTAGAAAAAATGAGIC forward
ICRCGGCCGGGACAACTCCAGTGAAAAGTTCTTCIC reverse
458FCCCATCCGAACGCAGHSV forward
603RCTGTGTAATCTCCGTCCAGTCGTTTATCTTCACHSV reverse
HSVPATTCCTGATGCACGCCCCCGCCTTCGAGACCGCGGGT-C6Unlabeled probe
HSVFSGGACCCGTTCCAGCCCCCCAGCATCCCGATCACHSV sequencing
HSVRSAGCGGGGGAGCATCCCGATGCTGTCHSV sequencing
HSVnestGCCTGCCGCAGCGTGCTCCHSV sequencing