Table 1.

Primers used for the APC gene QMPSF.

ExonForward primerReverse primerSize of the amplicon, bp
Multiplex 1
 1TTGTTTCCTTTACCCCTTTCTTTACAGTGCCTCAACTTGCTTTAACA1170
 3AGTAAAACTGCGGTCAAAAATGTC1CCTCTCTTTCTCAAGTTCTTCTAAATAT192
 8ATAATGTGCTTAATTTTTAGGGTTCAATGTTACCTTGGTTCCCAGATGACT1145
 10ACAAAGCATTATGGTTTATGTTGATTTTTTTGTCTTACCTAGTTCATTCATTGC1164
 11GACTACAGGCCATTGCAGAATTATT1AAAGTCAAGTTTGTCAAAGCCATTC138
 15 ITAAGTCCCAAGGCATCTCATCG1CTTTGAAGAAGTTCCTGGATTTTCT310
Multiplex 2
 2AGATGAAGCTATGGCTTCTTCTGG1CCTAAAGATGACAATTTGAGCTTAAAA131
 5ATGCTTTTTTGCTTTTACTGATTAACACTTACCTGTGCTCGTTTTTCCA1210
 6TTTTAAGTGGTAGCCATAGTATGATTATTACGAAGTATGTCCTTTTCGATTTG1150
 9CATTGTTGTCAATGCTTGGTACTC1GAGTGAATGATGTTGTGGAGTGCT249
 13GCATTGATGGAATGTGCTTTAGAA1TTGCAGTGAGCCAAGATCAGAC300
 15 IIIATCTGAAAGTAAAGGAATCAAAGGAG1CCTCTAGGAGAAGTGGTGGCTG293
Multiplex 3
 4AAATAGGTCATTGCTTCTTGCTGAT1AAGTTGTACTGCCAAGTTACTTACATTT159
 7AAAAGCCTTGGGCTAAGAAAGTTTACCTGACCATTACCAGAAGTTG1197
 12TTACAGGCTACGCTATGCTCTATGA1CAGAGGTTGCAGTGAGCTGAGAT220
 14GATGACCCATATTCTGTTTCTTACTAGGCCTGTGGTCCTCATTTGTAGCTATC1263
 15 IICAGGAGACCCCACTCATGTTTAG1TCTCTTTTCAGCAGTAGGTGCTTTAT278
 15 IVAGACCGTTTCCTCAGGTGCTAC1ACTGCCATTACCCACATTTTGTT268
Control
 HMBS2CTTCGCTGCATCGCTGAAAG1AACACCACCCTGTGACCACA256