Table 1.

Gene-specific primers and probes for TaqMan analysis.

GeneAlternative nameForward primer, 5′–3′Probe, 5′–3′Reverse primer, 5′–3′GenBank accession no.Position, bp
ABCA1ABC1TGTCCAGTCCAGTAATGGTTCTGTTACACCTGGAGAGAAGCTTTCAACGAGACTAACCCGAGATATGGTCCGGATTGCNM_0055021359–1439
ABCA2ABC2AAGCCTGTGGAGGATGATGTGTGGCCAGTGAGCGGCAGCGGGTCAACGGCCAGGATACGNM_0016066224–6365
ABCA3ABC3CAAAACCCTGGATCACGTGTTTGCTGCCCAACCACTGTCTGGGCCTCCGCGTCTCGTAGTTCTNM_0010894285–4375
ABCA4ABCRAAAGGTTGCAAACTGGAGTATTAAGAGCTGGGCCTGACTGTCTACGCCGATTGTTGCCCCCACTGTACGTNM_003506225–6308
ABCA5GGCTGCTATTCTGACCACTCACTATACAGAGGCTGTCTGTGATCGAGTAGCTTAACTGCCCAGACACCATGATNM_0186725462–5544
ABCA6CCATGAGAAATGTCCAGTTTCCTTCCTCAGAATCTGGGAAGGGTAGATAAATGCTGGGTTAAATTAGATATTGGTGTANM_080284324–438
ABCA7TTTCTCTGGGACATGTGTAACTACTTGCCTTCCAGCAGAGGGCATATGTGTGTGATCGACCAGCCATACAGXM_0551734337–4480
ABCA8TGCTTAGTCCCTTTGCCTTCAAATGGCCCAGCTTTTACACTTGGACTATGATTGAGCCGTCCGATGGATGANM_0071681226–1322
ABCA9CATTCAGACTGACAGAAGCACATTTTGGATTATGAGTATGGGTACCGAAGTAATCACCAATGCTGCTCATTGCNM_0802833152–3283
ABCA10ATCACAAACTGCGTTTCTCCTTTATCGGCATGAGCAGCATCAGCGACAGAGGCCTGAAATCCATAACTGNM_0802823703–3794
ABCA12CCTCCATTCAGCACCAAAGTCTCCTACCTGTCACTCCTACGGGCACTCGTGAGGTCACCCATGCCATTNM_0156574066–4141
ABCB1MDR1GTCCCAGGAGCCCATCCTTTGACTGCAGCATTGCTGAGAACATTGCCCCGGCTGTTGTCTCCATANM_0009273769–3836
ABCB2TAP1GGGTGACGGGATCTATAACAACACATGGGCCACGTGCACAGCCCCAAACAC CTCTCCCTGCAAXM_042533942–1007
ABCB3TAP2ACAGCCAGGTGGTTTCAGTTGCCTGTGCTGTTCTCCGGTTCTGCCCATAAGCAATGTTGTTCCTXM_1658241724–1798
ABCB4MDR3TTTTTACTTTCTTCCTTCAGGGTTTCCGTTTGGGAAAGCTGGCGAGATCCTAAAAGCCATTGACCGCAGTCTXM_1674662869–2949
ABCB5GCTCTGGCCCCTCAAACCCACCCTGACCTCCTGCTGCCTATGATGGCCTTGAGGTATGTGCAGTAU66692218–285
ABCB6MTABC3TGAAAGAGGAGACAGAAGTGAAGGACTGGAGCAGGGCCCCTTCGCAACTCAATACGGCCCTTCTGAAXM_0508911980–2052
ABCB7ABC7GATCCGGCCTTTAGTCTCTGTTAGAGGTCCGCAGTGGAGGCCACACCAAGGCGCCGAGTTGXM_03287788–155
ABCB8MABC1GAAGCGAATGCTCACGAGTTCTCACCAGCTTCCCCGAGGGCTTCACCGACGACCGTGTTGXM_0321651775–1836
ABCB9CGCCCACCTCCAACCAAGGATGCGGCTGTGGAAGGCGCGCAGATGTCCACACTCATGAXM_038794266–344
ABCB10MTABC2GCTTCCGTAGGCATCAGTATGATTTTTTTGTCTCACCTAATCTGGCCACCTTTGGGAGGCACCACGCTCAAAXM_001871941–1014
ABCB11BSEPAGGGAGCTACCAGGATAGTTTAAGGCTTCCATCCGGCAACGCTCCATCGTGCACCAGGTAAGAAAGCXM_0026442178–2253
ABCC11MRP1GAAGGCCATCGGACTCTTCACTCCTTCCTCAGCATCTTCCTTTTCATGTGCAGCGCGGACACATGGTL056283097–3166
ABCC21MRP2TGCAGCCTCCATAACCATGAGAGAGAGAACAGCTTTCGTCGAACACTTAGCCGATGCCTGCCATTGGACCTAU639702728–2807
ABCC31MRP3CACACGGATCTGACAGACAATGACCAGTCACCTATGTGGTCCAGAAGCAGTTTACAGGGCACTCAGCTGTCTCAAB_0108872670–2745
ABCC41MRP4AAGTGAACAACCTCCAGTTCCAGCAAACCGAAGACTCTGAGAAGGTACGATTCCTGGCTCTCCAGAGCACCATCTAF_0712022026–2144
ABCC51MRP5TGAAAGCCATTCGAGGAGTTGCTCGCAGCGTGCCCTTGACAAAGCGGAAAAGCTCGTCATGCAAF_1460742979–3054
ABCC61MRP6AGACACGGTTGACGTGGACATCCAGACAAACTCCGGTCCCTGCTGATGCTGACCTCCAGGAGTCCAAAF_1687913156–3231
ABCC7CFTRGGCACGAAGGAGGCAGTCTTGATGACACACTCAGTTAACCAAGGTCATCGTGTGGATGCTGTTGTCTTTXM_0049802418–2508
ABCC8SUR1CACCAATCAGCTCATGTGGTTTCCAGTACAGATCATTGTGGGTGTGATGGCACTGACTCCGAGTATGTAGTAGAXM_0363471398–1506
ABCC9SUR2CTACTCCTGTGTTCCTGGTTGCTTCCTGCCCCTTGGTGTTGCCAACCCGAAAGTATTTCTGGATAAAXM_0122433393–3467
ABCC10MRP7GCGGGTTAAGCTTGTGACAGACTGCTGAGTGGCATTCGGGTCCCCACCCGCAGAACTTGAXM_0527451585–1646
ABCC11MRP8AGGGTCTACCACCACTACATCCACAGCTGGAGGTTACATGGTCTCTTGCATAATTCGATCAGCACCACGAAGAAGNM_0331512721–2799
ABCC12MRP9TTCATCCAAAGGCCTGTCATTCATACATCATCCAGCTGAGCGGACTGCTCCGTTCGCACACACACTTGNM_0332263505–3575
ABCD1ALDCCTCTTTCTACAGCCTAATTTATTGGATCCCTATTCGTAGCCATCTCCGTGGCACGGTAGTCACATTGGNM_0000333244–3316
ABCD2ALDRGCTACCTTCGTCAACAGTGCAAAGGTACCTGGAATGCAAATTGGCTCGTGGTCTACTAGGCGAGTTCTGNM_0051641026–1104
ABCD3PMP70ACCCCTCTCAGTCTGCAGTATTGTGTTTAAAGTATATGTGCAGTCTTGCTTGATACATGGTAACCCCTCCTTGTXM_0404632497–2574
ABCD4PMP69GGCCCAGGTTAGATCTGCAACCAGCGGTTCCTGCAGATACTGATGATGACCAAGAAGGAAACAAAAACNM_00505089–162
ABCE1OABPGATCGCGTCATCGTTTTTGATGTTCCATCTAAGAACACAGTTGCAAACATGCCAGCCAAAAGGGTTTXM_017177578–654
ABCF1ABC50GAAGTTCAGCATCTCCGCTCATAGGAGCTGTTCGTCAATGCAGACCTGTACGGCGGCCGGCTACAANM_001090901–971
ABCF2TGGAGCAGGGAAGTCAACTCTTTGAAGCTGCTAACTGGAGAGCTACTACCTTTTCGGATCATGCCATCTGNM_0056921342–1414
ABCF3CCGGGAGTTGTGGGTATGCAAGGAGGCGGCGTCACCCGGTACTGGTCAAATCCTCCTTCCAU66685769–832
ABCG1WhiteCCGACCGACGACACAGAGATCTGATCCAACCCCTAGAACCGCGTGCACGAGACACCCACAAACCXM_0329502703–2772
ABCG21MXRCAGGTCTGTTGGTCAATCTCACACCATTGCATCTTGGCTGTCATGGCTTTCCATATCGTGGAATGCTGAAGAF_0989511893–1969
ABCG4White2GAGCCAGGGTCAGTGCATCTCAAAGGCGTGGTCACCAACCTGATCGCAAGCCGAGTCCCTTTAGAXM_012099823–893
ABCG5White3TCTCTTGGCCCCCCACTTATTGGTGAATTTCTAACTCTTGTGCTCTATATTTGGATTTTGGACGATACCANM_0224361655–1728
ABCG8White4TC GTACCCTCTCTACGCCATCTCGTCATTGGCCTCAGCGGTGGACACGTAGTACAGGACCATGAAXM_0555251999–2073